Sample ID: MG240613_4
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:27:59 |
| Analysis completed | 2025-05-03 01:27:59 |
| Wall time | 0:0:0 hours |
Inconclusive
Outcome: Identification not possible (potential unknown species).
Reasoning: [Flag 1E] No candidate species matched.
| Preliminary morphology ID confirmed? | NA |
|
Inconclusive taxonomic identity (Flag 1E) Empoascanara. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Empoascanara | |
| Coverage of species in genus Empoascanara | |
| Coverage of species in genus Empoascanara in country of origin Australia |
Flag 5.1A:
The reference data supports this taxon well
Reasoning: The given locus for this taxon is well represented in reference database (>5 entries)
There are 20 sequences in the reference database for Empoascanara at the given locus COI.
Global occurrence records for Empoascanara.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The reference data offers little support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
Reasoning: Not all species in genus from the country of origin have reference sequence(s) for this locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI
| Taxa of interest detected? | False |
|
Flag 2B: Taxon of interest NOT detected in candidate species Flag 5.1A: The given locus for this taxon is well represented in reference database (>5 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
| Locus | COI |
| Preliminary ID | Empoascanara |
| Taxa of interest |
Empoascanara |
| Country | Australia |
| Host | Urina |
| Sample ID | MG240613_4 |
| Query DNA sequence |
>MG240613_4 ATATTGGAACAATATATTTTATTTTTGGTGTTTGATCTGGAATTGTAGGTATAATGTTAA GTATATTAATTCGAATTGAATTAGCTCAGCCTGGGGCATTTTTAGCAAACGACCAATTAT ATAATGTAATTGTTACATCACATGCATTTATTATGATTTTTTTTATAGTTATACCAATTA TAATTGGAGGTTTTGGTAATTGATTATTACCTCTAATAATTGGAGCACCTGATATAGCAT TCCCTCGAATAAATAATATAAGATTCTGGCTTTTACCACCCTCATTAACCTTACTAATAT TAAGTTCAATAGTAGAAATAGGAGCTGGAACCGGATGAACAGTTTATCCTCCTTTATCTT CTAATATTGCTCATTCAGGAGCAAGAGTAGATTTAGCTATTTTTTCATTACATTTAGCTG GTATTTCCTCGATTTTAGGAGCAGTAAATTTTATTACAACAGTAATTAATATGCGTTCTG AAATATTAACACTTGACCGTATTCCTTTATTTGTTTGGTCAGTTCTAATTACAGCTGTTC TTTTATTATTATCATTACCAGTTTTAGCTGGAGCTATTACAATATTACTGACAGATCGAA ATTTGAATACTACTTTCTTTGATCCATCAGGAGGGGGGGATCCAATTTTGTACCAACATC TATTCTGA
Flag 1E:
Identification not possible (potential unknown species)
No candidate species matched
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 0 | 0 |
| MODERATE MATCH | ≥ 93.5% | 0 | 0 |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage |
|---|
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | OM600540 | Cicadellidae sp. voucher BIOUG23162-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 401 | 60.0% | 430.643 | 1.26e-115 | 88.5% |
| 2 | OM547033 | Cicadellidae sp. voucher BIOUG12767-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 401 | 60.0% | 424.696 | 7.80e-114 | 88.3% |
| 3 | MG398377 | Cicadellidae sp. BIOUG22002-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 468.306 | 5.81e-127 | 88.1% |
| 4 | MG402127 | Cicadellidae sp. BIOUG22002-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 478.217 | 6.03e-130 | 88.0% |
| 5 | KR572430 | Cicadellidae sp. BOLD-2016 voucher BIOUG13327-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 478.217 | 6.03e-130 | 88.0% |
| 6 | MG405288 | Cicadellidae sp. BIOUG22002-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 425 | 63.6% | 438.572 | 5.19e-118 | 88.0% |
| 7 | MG403329 | Cicadellidae sp. BIOUG22002-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 416 | 62.3% | 428.661 | 4.99e-115 | 88.0% |
| 8 | JQ344979 | Hemiptera sp. KMGHap_131 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 470.288 | 1.47e-127 | 87.9% |
| 9 | MG397209 | Cicadellidae sp. BIOUG22002-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 460.377 | 1.42e-124 | 87.9% |
| 10 | HM906804 | Sibovia sp. n. CCM069-10 voucher PT1_JRE_0069 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 468.306 | 5.81e-127 | 87.7% |
| 11 | JQ344978 | Hemiptera sp. KMGHap_130 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 462.359 | 3.58e-125 | 87.6% |
| 12 | KF920023 | Graphocephala sp. BOLD:AAY9932 voucher CNC#HEM401081 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 460.377 | 1.42e-124 | 87.5% |
| 13 | KR573520 | Cicadellidae sp. BOLD-2016 voucher BIOUG00891-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 454.43 | 8.73e-123 | 87.3% |
| 14 | MF929607 | Erythroneura elegans voucher BIOUG20489-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 412.803 | 2.97e-110 | 87.2% |
| 15 | KT619921 | Erythroneura elegans voucher BIOUG22461-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 412.803 | 2.97e-110 | 87.2% |
| 16 | MF933318 | Erythroneura elegans voucher BIOUG20490-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 412.803 | 2.97e-110 | 87.2% |
| 17 | MF932452 | Erythroneura elegans voucher BIOUG20489-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 412.803 | 2.97e-110 | 87.2% |
| 18 | MF936885 | Erythroneura elegans voucher BIOUG20489-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 406.856 | 1.83e-108 | 86.9% |
| 19 | MF935316 | Erythroneura elegans voucher BIOUG20490-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 406.856 | 1.83e-108 | 86.9% |
| 20 | MF938998 | Erythroneura elegans voucher BIOUG20490-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 406.856 | 1.83e-108 | 86.9% |
| 21 | KY509112 | Hemiptera sp. EMEC 1160082 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 404.874 | 7.23e-108 | 86.9% |
| 22 | KT621900 | Erythroneura elegans voucher BIOUG22082-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 428 | 64.1% | 404.874 | 7.23e-108 | 86.9% |
| 23 | MK055923 | Pandacerus aethiopicus voucher INHS92 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 463 | 69.3% | 434.608 | 8.10e-117 | 86.8% |
| 24 | MG401323 | Erythroneura vitifex voucher BIOUG25539-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 430.643 | 1.26e-115 | 86.7% |
| 25 | KR574175 | Erythroneura vitifex voucher BIOUG12028-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 428.661 | 4.99e-115 | 86.7% |
| 26 | JN311526 | Hemiptera sp. BOLD:AAG2883 voucher 10BBHEM-568 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 428.661 | 4.99e-115 | 86.6% |
| 27 | MF932927 | Erythroneura elegans voucher BIOUG20490-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 422.714 | 3.08e-113 | 86.6% |
| 28 | MF934819 | Erythroneura elegans voucher BIOUG20491-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 422.714 | 3.08e-113 | 86.6% |
| 29 | MF937177 | Erythroneura elegans voucher BIOUG20490-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 422.714 | 3.08e-113 | 86.6% |
| 30 | KR583398 | Erythroneura elegans voucher BIOUG05658-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 422.714 | 3.08e-113 | 86.6% |
| 31 | MG405220 | Erythroneura elegans voucher BIOUG25471-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 422.714 | 3.08e-113 | 86.6% |
| 32 | MF934940 | Erythroneura elegans voucher BIOUG20490-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 33 | MF935028 | Erythroneura elegans voucher BIOUG21286-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 34 | MF932269 | Erythroneura elegans voucher BIOUG20490-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 35 | MG398596 | Erythroneura elegans voucher BIOUG23071-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 36 | KT623855 | Erythroneura elegans voucher BIOUG22298-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 37 | MF937357 | Erythroneura elegans voucher BIOUG20490-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 38 | KR345626 | Erythroneura vitifex voucher BIOUG08740-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 39 | KR343649 | Erythroneura vitifex voucher BIOUG08740-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 40 | MF931652 | Erythroneura elegans voucher BIOUG20489-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 418.75 | 4.81e-112 | 86.6% |
| 41 | MG404655 | Erythroneura elegans voucher BIOUG25474-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 42 | MG402465 | Erythroneura vitifex voucher BIOUG25471-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 43 | KR579856 | Cicadellidae sp. BOLD:ABA5798 voucher BIOUG10730-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 44 | KR576835 | Cicadellidae sp. BOLD:ABA5798 voucher BIOUG08326-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 45 | MG398125 | Erythroneura vitifex voucher BIOUG21911-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 46 | MG404362 | Erythroneura elegans voucher BIOUG31026-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 422.714 | 3.08e-113 | 86.5% |
| 47 | MG404878 | Erythroneura elegans voucher BIOUG25474-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 48 | KR039549 | Erythroneura elegans voucher BIOUG02716-E03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 49 | MG397700 | Erythroneura elegans voucher BIOUG25474-F03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 422.714 | 3.08e-113 | 86.5% |
| 50 | MG400989 | Erythroneura vitifex voucher BIOUG31124-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 420.732 | 1.22e-112 | 86.5% |
| 51 | KT621995 | Erythroneura elegans voucher BIOUG22082-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 420.732 | 1.22e-112 | 86.5% |
| 52 | MF932351 | Erythroneura elegans voucher BIOUG20537-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 412.803 | 2.97e-110 | 86.5% |
| 53 | MF931934 | Erythroneura elegans voucher BIOUG20491-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 412.803 | 2.97e-110 | 86.5% |
| 54 | MF929543 | Erythroneura elegans voucher BIOUG20491-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 412.803 | 2.97e-110 | 86.5% |
| 55 | MF930681 | Erythroneura elegans voucher BIOUG20490-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 412.803 | 2.97e-110 | 86.5% |
| 56 | JN311525 | Hemiptera sp. BOLD:AAG2883 voucher 10BBHEM-567 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 420.732 | 1.22e-112 | 86.4% |
| 57 | MG403951 | Draeculacephala sp. BIOUG25578-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 420.732 | 1.22e-112 | 86.4% |
| 58 | MG401116 | Erythroneura elegans voucher BIOUG21968-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 416.767 | 1.90e-111 | 86.4% |
| 59 | MF929815 | Erythroneura elegans voucher BIOUG21840-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 416.767 | 1.90e-111 | 86.4% |
| 60 | MF932381 | Erythroneura elegans voucher BIOUG21286-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 461 | 69.0% | 416.767 | 1.90e-111 | 86.4% |
| 61 | KR572852 | Erythroneura elegans voucher BIOUG16068-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 412.803 | 2.97e-110 | 86.4% |
| 62 | MF933179 | Erythroneura elegans voucher BIOUG20489-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 412.803 | 2.97e-110 | 86.4% |
| 63 | MF930522 | Erythroneura elegans voucher BIOUG20489-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 412.803 | 2.97e-110 | 86.4% |
| 64 | MG401028 | Draeculacephala sp. BIOUG25578-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 410.821 | 1.17e-109 | 86.4% |
| 65 | MG402686 | Erythroneura elegans voucher BIOUG23199-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 410.821 | 1.17e-109 | 86.4% |
| 66 | KT621094 | Erythroneura elegans voucher BIOUG22355-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 410.821 | 1.17e-109 | 86.4% |
| 67 | KT619885 | Erythroneura elegans voucher BIOUG21768-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 410.821 | 1.17e-109 | 86.4% |
| 68 | KR341333 | Erythroneura vitifex voucher BIOUG09357-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 455 | 68.1% | 410.821 | 1.17e-109 | 86.4% |
| 69 | KR575471 | Erythroneura elegans voucher BIOUG08415-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 454 | 68.0% | 408.838 | 4.63e-109 | 86.4% |
| 70 | KY832958 | Cicadellidae sp. BIOUG05384-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 467 | 69.9% | 418.75 | 4.81e-112 | 86.3% |
| 71 | KJ084769 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02977-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 72 | KJ167955 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 73 | KJ164166 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03639-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 74 | KJ087301 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 75 | KJ166779 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 76 | KJ164362 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 77 | KR579059 | Erythroneura elegans voucher BIOUG16005-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 416.767 | 1.90e-111 | 86.3% |
| 78 | KJ166030 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03564-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 79 | KR564983 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG05893-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 80 | KJ163278 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03564-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 81 | KJ092585 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 82 | KJ083284 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 83 | KJ083527 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02986-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 84 | KJ167433 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03639-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 85 | KJ207706 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03926-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 86 | KJ166349 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 87 | KJ163423 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 88 | KJ163127 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03686-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 89 | KJ087188 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02986-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 90 | KJ167221 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 91 | MG398205 | Erythroneura vitifex voucher BIOUG21911-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 92 | KJ166545 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 93 | KJ088456 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 94 | KJ085617 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02996-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 95 | KR032203 | Erythroneura vitifex voucher BIOUG02717-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 96 | KJ086122 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02977-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 97 | KJ087262 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03070-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 98 | KJ091024 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02980-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 99 | KJ166604 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 100 | KJ088110 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02990-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 101 | KJ086875 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02991-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 102 | KJ167729 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-B12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 103 | KJ090956 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03447-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 104 | KJ085025 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02997-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 105 | KJ164115 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 106 | KJ093064 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02966-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 107 | KJ092129 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02996-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 108 | KR573807 | Erythroneura vitifex voucher BIOUG08688-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 109 | KJ091825 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 110 | KJ091369 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02997-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 111 | KJ166665 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 112 | KR570772 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG05893-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 113 | KJ166686 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03564-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 114 | KJ085974 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03000-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 414.785 | 7.51e-111 | 86.3% |
| 115 | MG512342 | Erythroneura elegans voucher BIOUG20978-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 453 | 67.8% | 406.856 | 1.83e-108 | 86.3% |
| 116 | MF929919 | Erythroneura elegans voucher BIOUG20490-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 406.856 | 1.83e-108 | 86.3% |
| 117 | MG511809 | Erythroneura vitifex voucher BIOUG10642-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 453 | 67.8% | 406.856 | 1.83e-108 | 86.3% |
| 118 | MG401830 | Erythroneura elegans voucher BIOUG21903-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 406.856 | 1.83e-108 | 86.3% |
| 119 | MF935576 | Erythroneura elegans voucher BIOUG21840-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 406.856 | 1.83e-108 | 86.3% |
| 120 | MG510157 | Erythroneura vitifex voucher BIOUG08453-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 453 | 67.8% | 406.856 | 1.83e-108 | 86.3% |
| 121 | KR570662 | Cicadellidae sp. BOLD:AAN8418 voucher BIOUG12028-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 452 | 67.7% | 404.874 | 7.23e-108 | 86.3% |
| 122 | MF933201 | Erythroneura elegans voucher BIOUG05893-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 414.785 | 7.51e-111 | 86.2% |
| 123 | MG397264 | Neokolla hieroglyphica voucher BIOUG21971-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 124 | KR036606 | Neokolla hieroglyphica voucher BIOUG00937-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 125 | MG402692 | Draeculacephala sp. BIOUG31067-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 126 | KR570551 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG05720-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 127 | MG405520 | Erythroneura vitifex voucher BIOUG31057-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 128 | KR568126 | Neokolla hieroglyphica voucher BIOUG07939-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 129 | KT623159 | Erythroneura vitifex voucher BIOUG21777-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 130 | KF920061 | Neokolla hieroglyphica voucher CNC#HEM401110 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 131 | KT620433 | Erythroneura vitifex voucher BIOUG22582-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 132 | KF919973 | Neokolla hieroglyphica voucher CNC#HEM401111 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 133 | KR043577 | Erythroneura vitifex voucher BIOUG01139-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 134 | KR579358 | Neokolla hieroglyphica voucher BIOUG00917-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 135 | KR033075 | Neokolla hieroglyphica voucher BIOUG01019-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 136 | KR564037 | Draeculacephala sp. BOLD-2016 voucher BIOUG08378-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 137 | KR572596 | Neokolla hieroglyphica voucher BIOUG07939-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 412.803 | 2.97e-110 | 86.2% |
| 138 | KR042461 | Neokolla hieroglyphica voucher BIOUG09176-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 457 | 68.4% | 406.856 | 1.83e-108 | 86.2% |
| 139 | MT756006 | Cicadella viridis isolate YC3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 596 | 89.2% | 523.81 | 1.14e-143 | 86.1% |
| 140 | KJ167295 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03686-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 141 | KJ163606 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03564-E07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 142 | KJ088754 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02994-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 143 | KJ166270 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 144 | KJ166212 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03516-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 145 | KJ164488 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03634-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 146 | KJ089233 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03447-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 147 | KJ166556 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 148 | MG399376 | Erythroneura elegans voucher BIOUG31039-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 149 | KJ087481 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02994-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 408.838 | 4.63e-109 | 86.1% |
| 150 | KJ088922 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02990-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 406.856 | 1.83e-108 | 86.1% |
| 151 | KF920148 | Draeculacephala balli voucher CNC#HEM400207 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 406.856 | 1.83e-108 | 86.1% |
| 152 | HQ928902 | Draeculacephala balli voucher BIOUG| 465 |
69.6% |
406.856 |
1.83e-108 |
86.1% |
|
| 153 | MG406314 | Erythroneura vitifex voucher BIOUG16056-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 406.856 | 1.83e-108 | 86.1% |
| 154 | KJ165233 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 406.856 | 1.83e-108 | 86.1% |
| 155 | MT756005 | Cicadella viridis isolate YC2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 596 | 89.2% | 515.88 | 2.77e-141 | 86.0% |
| 156 | MG511352 | Erythroneura rubrella voucher BIOUG10642-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 465 | 69.6% | 406.856 | 1.83e-108 | 86.0% |
| 157 | KR030550 | Neokolla hieroglyphica voucher 12-4-108 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 158 | MG400642 | Erythroneura vitifex voucher BIOUG21911-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 159 | HQ978672 | Hemiptera sp. BOLD:AAN8418 voucher BIOUG| 464 |
69.5% |
404.874 |
7.23e-108 |
86.0% |
|
| 160 | KT707529 | Neokolla hieroglyphica voucher BIOUG24017-D12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 161 | MF829446 | Neokolla hieroglyphica voucher BIOUG20301-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 162 | KR583246 | Neokolla hieroglyphica voucher BIOUG07939-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 163 | KR569611 | Neokolla hieroglyphica voucher BIOUG08039-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 164 | KR582260 | Neokolla hieroglyphica voucher BIOUG07939-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 165 | KR578103 | Neokolla hieroglyphica voucher BIOUG08039-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 464 | 69.5% | 404.874 | 7.23e-108 | 86.0% |
| 166 | HM906807 | Plesiommata mollicela voucher PT1_JRE_0073 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 490.111 | 1.59e-133 | 85.7% |
| 167 | MZ656589 | Cicadella viridis voucher ZMUO.026536 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 547.597 | 7.86e-151 | 85.6% |
| 168 | JQ344519 | Hemiptera sp. hongheHap_160 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 610 | 91.3% | 511.916 | 4.33e-140 | 85.6% |
| 169 | ON142388 | Cicadella viridis isolate jilin cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 664 | 99.4% | 547.597 | 7.86e-151 | 85.5% |
| 170 | KU324161 | Cicadella viridis isolate CV3 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 634 | 94.9% | 527.774 | 7.29e-145 | 85.5% |
| 171 | KU258182 | Cicadella viridis cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 632 | 94.6% | 523.81 | 1.14e-143 | 85.5% |
| 172 | MF716880 | Cicadella viridis voucher ZYJ27 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 539.668 | 1.91e-148 | 85.4% |
| 173 | KC135928 | Cicadella viridis voucher O-11-ich-0901-0004 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 539.668 | 1.91e-148 | 85.4% |
| 174 | KR346824 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG12701-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.4% |
| 175 | KR345491 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG08595-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.4% |
| 176 | KR345658 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG08619-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.4% |
| 177 | KR346360 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG08619-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.4% |
| 178 | KR345344 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG08619-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.4% |
| 179 | KY752061 | Cicadella viridis mitochondrion, partial genome | 664 | 99.4% | 539.668 | 1.91e-148 | 85.3% |
| 180 | OM578481 | Cicadellidae sp. voucher BIOUG23244-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 88.3% | 480.2 | 1.53e-130 | 85.3% |
| 181 | MG405026 | Erythroneura sp. BIOUG00936-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 516 | 77.2% | 420.732 | 1.22e-112 | 85.3% |
| 182 | MG401666 | Erythroneura elegans voucher BIOUG22015-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 516 | 77.2% | 420.732 | 1.22e-112 | 85.3% |
| 183 | KR342344 | Erythroneura rubrella voucher BIOUG10214-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.3% |
| 184 | KR346192 | Erythroneura rubrella voucher BIOUG10214-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.3% |
| 185 | KR340763 | Erythroneura rubrella voucher BIOUG10214-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 416.767 | 1.90e-111 | 85.3% |
| 186 | KY847230 | Cicadellidae sp. BIOUG05384-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 77.1% | 418.75 | 4.81e-112 | 85.2% |
| 187 | MF930505 | Erythroneura rubrella voucher BIOUG20490-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 77.1% | 418.75 | 4.81e-112 | 85.2% |
| 188 | MF716879 | Cicadella viridis voucher ZYJ35 cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 523.81 | 1.14e-143 | 85.1% |
| 189 | OM575217 | Cicadellidae sp. voucher BIOUG23231-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 88.3% | 474.253 | 9.42e-129 | 85.1% |
| 190 | KR560361 | Erythroneura sp. BOLD-2016 voucher BIOUG12028-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 515 | 77.1% | 410.821 | 1.17e-109 | 85.1% |
| 191 | KR343221 | Erythroneura rubrella voucher BIOUG10209-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 192 | KR346856 | Erythroneura rubrella voucher BIOUG10525-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 193 | KR346603 | Erythroneura rubrella voucher BIOUG10525-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 194 | KR343932 | Erythroneura rubrella voucher BIOUG09357-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 195 | KR037017 | Erythroneura rubrella voucher BIOUG02829-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 196 | KR346566 | Erythroneura rubrella voucher BIOUG10209-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 197 | MG402837 | Erythroneura rubrella voucher BIOUG28272-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 198 | MG399403 | Erythroneura rubrella voucher BIOUG28272-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 199 | KR346063 | Erythroneura rubrella voucher BIOUG10525-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 200 | MG401566 | Erythroneura rubrella voucher BIOUG28272-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 201 | KR344669 | Erythroneura rubrella voucher BIOUG09364-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 202 | MG397343 | Erythroneura rubrella voucher BIOUG25131-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 203 | KR033725 | Erythroneura rubrella voucher BIOUG02829-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 204 | MG404638 | Erythroneura rubrella voucher BIOUG28262-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 205 | KR342067 | Erythroneura rubrella voucher BIOUG10525-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 206 | MG398524 | Erythroneura rubrella voucher BIOUG28554-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 207 | KR343127 | Erythroneura rubrella voucher BIOUG09364-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 208 | MG398614 | Erythroneura rubrella voucher BIOUG21958-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 209 | KR041630 | Erythroneura rubrella voucher BIOUG02829-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 210 | KR343546 | Erythroneura rubrella voucher BIOUG09357-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 211 | KR562557 | Erythroneura rubrella voucher BIOUG05725-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 212 | KR044623 | Erythroneura rubrella voucher BIOUG02829-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 213 | KR043879 | Erythroneura rubrella voucher BIOUG02829-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 214 | KR345762 | Erythroneura rubrella voucher BIOUG10209-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 215 | KR341119 | Erythroneura rubrella voucher BIOUG09357-D02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 216 | KR344001 | Erythroneura rubrella voucher BIOUG10209-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 217 | MG405571 | Erythroneura rubrella voucher BIOUG25131-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 218 | KR341021 | Erythroneura rubrella voucher BIOUG10209-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 219 | KR343910 | Erythroneura rubrella voucher BIOUG10525-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 220 | KR345377 | Erythroneura rubrella voucher BIOUG10525-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 510 | 76.3% | 408.838 | 4.63e-109 | 85.1% |
| 221 | KR346466 | Erythroneura rubrella voucher BIOUG09357-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 509 | 76.2% | 406.856 | 1.83e-108 | 85.1% |
| 222 | KJ164471 | Erythroneura rubrella voucher BIOUG03639-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 552 | 82.6% | 436.59 | 2.05e-117 | 85.0% |
| 223 | OM582299 | Cicadellidae sp. voucher BIOUG23442-F05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 472.271 | 3.72e-128 | 84.9% |
| 224 | KR344848 | Typhlocybinae sp. BOLD:AAG8851 voucher BIOUG09225-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 81.7% | 424.696 | 7.80e-114 | 84.9% |
| 225 | KR570802 | Erythroneura rubrella voucher BIOUG05718-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 536 | 80.2% | 420.732 | 1.22e-112 | 84.9% |
| 226 | MF930156 | Erythroneura rubrella voucher BIOUG20489-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 536 | 80.2% | 420.732 | 1.22e-112 | 84.9% |
| 227 | KR571075 | Erythroneura rubrella voucher BIOUG05720-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 524 | 78.4% | 412.803 | 2.97e-110 | 84.9% |
| 228 | MW535965 | Cicadella viridis voucher INV00537 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 507.951 | 6.76e-139 | 84.8% |
| 229 | FR775764 | Cicadella viridis mitochondrial partial COI gene for cytochrome oxidase subunit 1 | 656 | 98.2% | 507.951 | 6.76e-139 | 84.8% |
| 230 | OM549222 | Cicadellidae sp. voucher BIOUG22752-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.6% | 450.466 | 1.36e-121 | 84.8% |
| 231 | OM577651 | Cicadellidae sp. voucher BIOUG23441-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 468.306 | 5.81e-127 | 84.7% |
| 232 | OM558185 | Cicadellidae sp. voucher BIOUG13972-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.8% | 458.395 | 5.59e-124 | 84.7% |
| 233 | MF932032 | Erythroneura rubrella voucher BIOUG20491-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 555 | 83.1% | 426.679 | 1.97e-114 | 84.7% |
| 234 | KR570499 | Erythroneura rubrella voucher BIOUG05720-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 82.0% | 420.732 | 1.22e-112 | 84.7% |
| 235 | KR570021 | Erythroneura rubrella voucher BIOUG05720-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 548 | 82.0% | 420.732 | 1.22e-112 | 84.7% |
| 236 | MG404458 | Erythroneura rubrella voucher BIOUG22031-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 81.3% | 418.75 | 4.81e-112 | 84.7% |
| 237 | MG405498 | Erythroneura rubrella voucher BIOUG22031-F10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 81.3% | 418.75 | 4.81e-112 | 84.7% |
| 238 | MF931691 | Erythroneura rubrella voucher BIOUG20489-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 536 | 80.2% | 414.785 | 7.51e-111 | 84.7% |
| 239 | KR567932 | Erythroneura rubrella voucher BIOUG05720-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 536 | 80.2% | 412.803 | 2.97e-110 | 84.7% |
| 240 | OM559687 | Cicadellidae sp. voucher BIOUG13972-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 89.2% | 452.448 | 3.45e-122 | 84.6% |
| 241 | OM551113 | Cicadellidae sp. voucher BIOUG22752-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.6% | 438.572 | 5.19e-118 | 84.6% |
| 242 | KR565330 | Erythridula sp. BOLD-2016 voucher BIOUG05609-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 542 | 81.1% | 408.838 | 4.63e-109 | 84.6% |
| 243 | OQ389576 | Zygina rhamni isolate Haplotype 10 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 492.093 | 4.01e-134 | 84.5% |
| 244 | MF932321 | Cicadellidae sp. BIOUG20490-C12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 484.164 | 9.78e-132 | 84.5% |
| 245 | OM588974 | Cicadellidae sp. voucher BIOUG13225-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 436.59 | 2.05e-117 | 84.5% |
| 246 | OM588314 | Cicadellidae sp. voucher BIOUG13225-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 434.608 | 8.10e-117 | 84.5% |
| 247 | KR342189 | Erythroneura rubrella voucher BIOUG09357-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 547 | 81.9% | 412.803 | 2.97e-110 | 84.5% |
| 248 | KR577858 | Erythroneura rubrella voucher 10PHMAL-1647 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 547 | 81.9% | 410.821 | 1.17e-109 | 84.5% |
| 249 | MF931804 | Erythroneura rubrella voucher BIOUG20977-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 81.3% | 410.821 | 1.17e-109 | 84.5% |
| 250 | KR571505 | Erythroneura rubrella voucher BIOUG16052-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 81.3% | 410.821 | 1.17e-109 | 84.5% |
| 251 | MG404210 | Erythroneura rubrella voucher BIOUG25471-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 543 | 81.3% | 410.821 | 1.17e-109 | 84.5% |
| 252 | KR567005 | Erythridula sp. BOLD-2016 voucher BIOUG00917-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 546 | 81.7% | 408.838 | 4.63e-109 | 84.5% |
| 253 | OQ389571 | Zygina rhamni isolate Haplotype 5 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 484.164 | 9.78e-132 | 84.4% |
| 254 | OQ389573 | Zygina rhamni isolate Haplotype 7 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 484.164 | 9.78e-132 | 84.4% |
| 255 | OM543879 | Cicadellidae sp. voucher BIOUG22752-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 452.448 | 3.45e-122 | 84.4% |
| 256 | OM575660 | Cicadellidae sp. voucher BIOUG23231-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 88.3% | 440.554 | 1.31e-118 | 84.4% |
| 257 | KR562799 | Erythroneura rubrella voucher BIOUG08493-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 85.2% | 422.714 | 3.08e-113 | 84.4% |
| 258 | KR576242 | Erythroneura rubrella voucher BIOUG05718-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 85.2% | 422.714 | 3.08e-113 | 84.4% |
| 259 | KR570718 | Erythroneura rubrella voucher BIOUG05718-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 569 | 85.2% | 422.714 | 3.08e-113 | 84.4% |
| 260 | OM575224 | Cicadellidae sp. voucher BIOUG23441-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 460.377 | 1.42e-124 | 84.3% |
| 261 | OM578740 | Cicadellidae sp. voucher BIOUG12906-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 458.395 | 5.59e-124 | 84.3% |
| 262 | OM579995 | Cicadellidae sp. voucher BIOUG12905-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 458.395 | 5.59e-124 | 84.3% |
| 263 | KJ165946 | Erythroneura rubrella voucher BIOUG03443-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.3% |
| 264 | KJ084734 | Erythroneura rubrella voucher BIOUG03443-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.8% | 438.572 | 5.19e-118 | 84.3% |
| 265 | OM548937 | Cicadellidae sp. voucher BIOUG12768-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 434.608 | 8.10e-117 | 84.3% |
| 266 | OM605297 | Cicadellidae sp. voucher BIOUG13887-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 434.608 | 8.10e-117 | 84.3% |
| 267 | OM547204 | Cicadellidae sp. voucher BIOUG22751-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 426.679 | 1.97e-114 | 84.3% |
| 268 | OM713048 | Cicadellidae sp. voucher BIOUG13223-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 426.679 | 1.97e-114 | 84.3% |
| 269 | KR575056 | Erythroneura rubrella voucher BIOUG05893-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 573 | 85.8% | 422.714 | 3.08e-113 | 84.3% |
| 270 | OM708828 | Cicadellidae sp. voucher BIOUG12933-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 572 | 85.6% | 420.732 | 1.22e-112 | 84.3% |
| 271 | MG405268 | Draeculacephala sp. BIOUG22593-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 570 | 85.3% | 416.767 | 1.90e-111 | 84.3% |
| 272 | OQ389574 | Zygina rhamni isolate Haplotype 8 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 476.235 | 2.38e-129 | 84.2% |
| 273 | OQ389570 | Zygina rhamni isolate Haplotype 4 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 476.235 | 2.38e-129 | 84.2% |
| 274 | MK907370 | Oragua partitula voucher CCDB-30312-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 472.271 | 3.72e-128 | 84.2% |
| 275 | MK907396 | Oragua partitula voucher CCDB-30312-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 472.271 | 3.72e-128 | 84.2% |
| 276 | OM551104 | Cicadellidae sp. voucher BIOUG22917-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 450.466 | 1.36e-121 | 84.2% |
| 277 | KR036479 | Erythroneura rubrella voucher BIOUG01643-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 614 | 91.9% | 448.484 | 5.39e-121 | 84.2% |
| 278 | OM313734 | Cicadellidae sp. voucher BIOUG24427-B10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 444.519 | 8.41e-120 | 84.2% |
| 279 | OM543656 | Cicadellidae sp. voucher BIOUG12769-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 442.537 | 3.32e-119 | 84.2% |
| 280 | KJ085073 | Erythroneura rubrella voucher BIOUG02994-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 281 | KR564118 | Erythroneura rubrella voucher BIOUG05893-G02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 282 | OM584105 | Cicadellidae sp. voucher BIOUG12904-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 442.537 | 3.32e-119 | 84.2% |
| 283 | OM590486 | Cicadellidae sp. voucher BIOUG23821-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 442.537 | 3.32e-119 | 84.2% |
| 284 | KJ163218 | Erythroneura rubrella voucher BIOUG03447-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 285 | KJ163052 | Erythroneura rubrella voucher BIOUG03686-C05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 286 | KR577309 | Erythroneura rubrella voucher BIOUG05893-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 287 | OM547002 | Cicadellidae sp. voucher BIOUG22752-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 442.537 | 3.32e-119 | 84.2% |
| 288 | KJ164727 | Erythroneura rubrella voucher BIOUG03516-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 289 | KJ163115 | Erythroneura rubrella voucher BIOUG03685-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 290 | KJ167946 | Erythroneura rubrella voucher BIOUG03685-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 291 | KJ087875 | Erythroneura rubrella voucher BIOUG03040-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 292 | KJ085185 | Erythroneura rubrella voucher BIOUG02993-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 293 | KR569014 | Erythroneura rubrella voucher BIOUG05893-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 294 | KJ087232 | Erythroneura rubrella voucher BIOUG02944-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 295 | KR573100 | Erythroneura rubrella voucher BIOUG05893-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 442.537 | 3.32e-119 | 84.2% |
| 296 | OM584012 | Cicadellidae sp. voucher BIOUG12904-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.2% |
| 297 | OM709204 | Cicadellidae sp. voucher BIOUG23739-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.2% |
| 298 | OM556362 | Cicadellidae sp. voucher BIOUG13971-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 89.2% | 440.554 | 1.31e-118 | 84.2% |
| 299 | OM588349 | Cicadellidae sp. voucher BIOUG23821-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.2% |
| 300 | OM585804 | Cicadellidae sp. voucher BIOUG23821-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.2% |
| 301 | OM590901 | Cicadellidae sp. voucher BIOUG23821-D08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.2% |
| 302 | OM590772 | Cicadellidae sp. voucher BIOUG13156-G04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 89.2% | 436.59 | 2.05e-117 | 84.2% |
| 303 | OM583726 | Cicadellidae sp. voucher BIOUG23231-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 88.3% | 436.59 | 2.05e-117 | 84.2% |
| 304 | OM545022 | Cicadellidae sp. voucher BIOUG12768-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 84.4% | 422.714 | 3.08e-113 | 84.2% |
| 305 | KJ163335 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02983-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 420.732 | 1.22e-112 | 84.2% |
| 306 | OM589339 | Cicadellidae sp. voucher BIOUG13225-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 564 | 84.4% | 412.803 | 2.97e-110 | 84.2% |
| 307 | OQ389575 | Zygina rhamni isolate Haplotype 9 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 468.306 | 5.81e-127 | 84.1% |
| 308 | OQ389568 | Zygina rhamni isolate Haplotype 2 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 468.306 | 5.81e-127 | 84.1% |
| 309 | OQ389569 | Zygina rhamni isolate Haplotype 3 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 468.306 | 5.81e-127 | 84.1% |
| 310 | OQ389572 | Zygina rhamni isolate Haplotype 6 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 468.306 | 5.81e-127 | 84.1% |
| 311 | HQ929002 | Cicadellidae sp. BOLD:AAN8248 voucher BIOUG| 651 |
97.5% |
466.324 |
2.29e-126 |
84.1% |
|
| 312 | MK907338 | Oragua partitula voucher CCDB-30312-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 464.342 | 9.07e-126 | 84.1% |
| 313 | OM578739 | Cicadellidae sp. voucher BIOUG22758-C02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 458.395 | 5.59e-124 | 84.1% |
| 314 | OM546858 | Cicadellidae sp. voucher BIOUG12767-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 450.466 | 1.36e-121 | 84.1% |
| 315 | OM578456 | Cicadellidae sp. voucher BIOUG12880-H02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 450.466 | 1.36e-121 | 84.1% |
| 316 | OM548907 | Cicadellidae sp. voucher BIOUG22752-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 450.466 | 1.36e-121 | 84.1% |
| 317 | OM544311 | Cicadellidae sp. voucher BIOUG12866-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 450.466 | 1.36e-121 | 84.1% |
| 318 | OM708985 | Cicadellidae sp. voucher BIOUG12933-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 450.466 | 1.36e-121 | 84.1% |
| 319 | KR041112 | Draeculacephala crassicornis voucher 10BBCHEM-0705 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 626 | 93.7% | 448.484 | 5.39e-121 | 84.1% |
| 320 | OM560425 | Cicadellidae sp. voucher BIOUG14038-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 440.554 | 1.31e-118 | 84.1% |
| 321 | KJ165815 | Erythroneura rubrella voucher BIOUG03686-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 436.59 | 2.05e-117 | 84.1% |
| 322 | KJ167811 | Erythroneura rubrella voucher BIOUG03634-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 323 | KJ086749 | Erythroneura rubrella voucher BIOUG02961-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 324 | KJ164984 | Erythroneura rubrella voucher BIOUG03734-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 325 | KR564225 | Erythroneura rubrella voucher BIOUG05894-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 326 | KJ164398 | Erythroneura rubrella voucher BIOUG03516-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 327 | KR033747 | Erythroneura rubrella voucher BIOUG00936-A08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 328 | KR569744 | Erythroneura rubrella voucher BIOUG05894-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 329 | KJ166510 | Erythroneura rubrella voucher BIOUG03685-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 330 | KR035997 | Erythroneura vitifex voucher BIOUG02717-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 331 | KJ091185 | Erythroneura rubrella voucher BIOUG02977-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 332 | KR582968 | Erythroneura rubrella voucher BIOUG05894-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 333 | OM593483 | Cicadellidae sp. voucher BIOUG13225-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 596 | 89.2% | 434.608 | 8.10e-117 | 84.1% |
| 334 | KJ083823 | Erythroneura rubrella voucher BIOUG03439-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 335 | KR582608 | Erythroneura rubrella voucher BIOUG05894-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 336 | KJ167667 | Erythroneura rubrella voucher BIOUG03686-A07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 337 | KJ165495 | Erythroneura rubrella voucher BIOUG03734-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 338 | KJ089290 | Erythroneura rubrella voucher BIOUG03443-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 339 | KR043105 | Erythroneura vitifex voucher BIOUG02715-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 340 | KJ084812 | Erythroneura rubrella voucher BIOUG02966-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 341 | KR564902 | Erythroneura rubrella voucher BIOUG05893-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 342 | KR575372 | Erythroneura rubrella voucher BIOUG05894-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 343 | KJ088090 | Erythroneura rubrella voucher BIOUG02944-E10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 344 | KJ164022 | Erythroneura rubrella voucher BIOUG03637-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 345 | KJ163497 | Erythroneura rubrella voucher BIOUG03685-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 434.608 | 8.10e-117 | 84.1% |
| 346 | OM582552 | Cicadellidae sp. voucher BIOUG12904-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 579 | 86.7% | 420.732 | 1.22e-112 | 84.1% |
| 347 | KR043199 | Erythroneura rubrella voucher BIOUG01595-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 468.306 | 5.81e-127 | 84.0% |
| 348 | KR033347 | Erythroneura rubrella voucher BIOUG00936-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 466.324 | 2.29e-126 | 84.0% |
| 349 | KJ445634 | Erythroneura rubrella voucher BIOUG03768-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 466.324 | 2.29e-126 | 84.0% |
| 350 | KJ164263 | Erythroneura rubrella voucher BIOUG03637-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 448.484 | 5.39e-121 | 84.0% |
| 351 | KJ083392 | Erythroneura rubrella voucher BIOUG02999-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 448.484 | 5.39e-121 | 84.0% |
| 352 | KJ167762 | Erythroneura rubrella voucher BIOUG03637-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 448.484 | 5.39e-121 | 84.0% |
| 353 | KR583346 | Erythroneura rubrella voucher BIOUG05894-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 448.484 | 5.39e-121 | 84.0% |
| 354 | KJ166796 | Erythroneura rubrella voucher BIOUG03639-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 446.501 | 2.13e-120 | 84.0% |
| 355 | KJ083566 | Erythroneura rubrella voucher BIOUG02961-C11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 444.519 | 8.41e-120 | 84.0% |
| 356 | KJ090783 | Erythroneura rubrella voucher BIOUG02997-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 444.519 | 8.41e-120 | 84.0% |
| 357 | KJ085705 | Erythroneura rubrella voucher BIOUG02991-E05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 444.519 | 8.41e-120 | 84.0% |
| 358 | KJ165149 | Erythroneura rubrella voucher BIOUG03634-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 444.519 | 8.41e-120 | 84.0% |
| 359 | MF935220 | Erythroneura vitifex voucher BIOUG21027-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 593 | 88.8% | 422.714 | 3.08e-113 | 84.0% |
| 360 | KJ087468 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02961-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 412.803 | 2.97e-110 | 84.0% |
| 361 | KJ091465 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02966-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 412.803 | 2.97e-110 | 84.0% |
| 362 | KJ088205 | Arboridia sp. BOLD:AAN8285 voucher BIOUG03214-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 412.803 | 2.97e-110 | 84.0% |
| 363 | KJ085144 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02980-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 412.803 | 2.97e-110 | 84.0% |
| 364 | KJ088094 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02980-E08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 412.803 | 2.97e-110 | 84.0% |
| 365 | KF919344 | Draeculacephala crassicornis voucher CNC#HEM400208 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 460.377 | 1.42e-124 | 83.9% |
| 366 | HM907509 | Hemiptera sp. BOLD:AAG8686 voucher CHUCD-0036 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 460.377 | 1.42e-124 | 83.9% |
| 367 | OQ389567 | Zygina rhamni isolate Haplotype 1 cytochrome c oxidase subunit I (COX1) gene, partial cds; mitochondrial | 656 | 98.2% | 460.377 | 1.42e-124 | 83.9% |
| 368 | KR032877 | Draeculacephala crassicornis voucher 10BBCHEM-0704 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 460.377 | 1.42e-124 | 83.9% |
| 369 | KR031431 | Erythroneura rubrella voucher BIOUG00891-G10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 458.395 | 5.59e-124 | 83.9% |
| 370 | KY264056 | Graphocephala coccinea isolate LH15 cytochrome oxidase subunit I (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 456.413 | 2.21e-123 | 83.9% |
| 371 | MK907351 | Oragua partitula voucher CCDB-30312-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 456.413 | 2.21e-123 | 83.9% |
| 372 | KR042048 | Erythroneura vitifex voucher BIOUG02718-C07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 373 | KJ167858 | Erythroneura rubrella voucher BIOUG03686-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 374 | KR578381 | Erythroneura rubrella voucher BIOUG05893-B05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 375 | KR566289 | Erythroneura rubrella voucher BIOUG05894-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 376 | KR034503 | Erythroneura vitifex voucher BIOUG02504-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 377 | KJ163380 | Erythroneura rubrella voucher BIOUG03686-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 378 | KJ164975 | Erythroneura rubrella voucher BIOUG02997-D01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 379 | KR564220 | Erythroneura rubrella voucher BIOUG05893-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 380 | KJ166640 | Erythroneura rubrella voucher BIOUG03564-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 381 | KR560483 | Erythroneura rubrella voucher BIOUG05893-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 382 | KJ167330 | Erythroneura rubrella voucher BIOUG03685-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 383 | KR565480 | Erythroneura rubrella voucher BIOUG05893-H08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 426.679 | 1.97e-114 | 83.9% |
| 384 | KR040582 | Erythroneura vitifex voucher BIOUG02504-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 424.696 | 7.80e-114 | 83.9% |
| 385 | OM578039 | Cicadellidae sp. voucher BIOUG22992-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 590 | 88.3% | 424.696 | 7.80e-114 | 83.9% |
| 386 | HM907511 | Hemiptera sp. BOLD:AAG8686 voucher CHUCD-0039 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 454.43 | 8.73e-123 | 83.8% |
| 387 | KF920030 | Homalodisca elongata voucher CNC#HEM401084 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 454.43 | 8.73e-123 | 83.8% |
| 388 | KR579809 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG01755-F07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 450.466 | 1.36e-121 | 83.8% |
| 389 | KR573177 | Erythroneura rubrella voucher BIOUG05893-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 442.537 | 3.32e-119 | 83.8% |
| 390 | KJ087231 | Erythroneura rubrella voucher BIOUG03340-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 391 | KJ163291 | Erythroneura rubrella voucher BIOUG03640-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 392 | KR033066 | Erythroneura rubrella voucher BIOUG04225-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 440.554 | 1.31e-118 | 83.8% |
| 393 | KR033740 | Erythroneura vitifex voucher BIOUG01139-B09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 440.554 | 1.31e-118 | 83.8% |
| 394 | KR038813 | Erythroneura rubrella voucher BIOUG04225-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 440.554 | 1.31e-118 | 83.8% |
| 395 | KJ091963 | Erythroneura rubrella voucher BIOUG02983-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 396 | KJ085143 | Erythroneura rubrella voucher BIOUG03342-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 397 | KJ086808 | Erythroneura rubrella voucher BIOUG02980-A01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 398 | KJ167767 | Erythroneura rubrella voucher BIOUG03635-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 440.554 | 1.31e-118 | 83.8% |
| 399 | KJ092276 | Erythroneura rubrella voucher BIOUG02991-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 400 | KJ086283 | Erythroneura rubrella voucher BIOUG02961-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 401 | KR561667 | Erythroneura rubrella voucher BIOUG05894-E12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 402 | KR044111 | Erythroneura rubrella voucher BIOUG03716-E06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 403 | KJ445502 | Erythroneura rubrella voucher BIOUG03768-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 404 | KJ089610 | Erythroneura rubrella voucher BIOUG02993-C01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 405 | KJ092683 | Erythroneura rubrella voucher BIOUG02991-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 436.59 | 2.05e-117 | 83.8% |
| 406 | KR045249 | Erythroneura vitifex voucher BIOUG01139-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 422.714 | 3.08e-113 | 83.8% |
| 407 | MF937352 | Erythroneura sp. BIOUG20490-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.8% |
| 408 | KR039064 | Erythroneura vitifex voucher BIOUG02715-F08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.8% |
| 409 | KR031017 | Erythroneura vitifex voucher BIOUG02636-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.8% |
| 410 | KR032789 | Erythroneura vitifex voucher BIOUG02718-A06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.8% |
| 411 | KR042061 | Erythroneura rubrella voucher BIOUG02719-A04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 597 | 89.4% | 414.785 | 7.51e-111 | 83.8% |
| 412 | KJ163741 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02957-A12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 408.838 | 4.63e-109 | 83.8% |
| 413 | MG399625 | Erythridula sp. BIOUG31049-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 406.856 | 1.83e-108 | 83.8% |
| 414 | KJ093035 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02994-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 406.856 | 1.83e-108 | 83.8% |
| 415 | KJ092451 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02977-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 404.874 | 7.23e-108 | 83.8% |
| 416 | KR577533 | Erythridula sp. BOLD-2016 voucher BIOUG02517-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 580 | 86.8% | 404.874 | 7.23e-108 | 83.8% |
| 417 | KR033646 | Erythroneura rubrella voucher BIOUG00936-G11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 450.466 | 1.36e-121 | 83.7% |
| 418 | KR040278 | Erythroneura rubrella voucher BIOUG00906-C03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 450.466 | 1.36e-121 | 83.7% |
| 419 | KR044612 | Erythroneura rubrella voucher BIOUG00936-G08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 450.466 | 1.36e-121 | 83.7% |
| 420 | KR031669 | Erythroneura rubrella voucher BIOUG00917-G03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 450.466 | 1.36e-121 | 83.7% |
| 421 | KF919545 | Neokolla severini voucher CNC#HEM401126 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 646 | 96.7% | 440.554 | 1.31e-118 | 83.7% |
| 422 | KJ090181 | Erythroneura rubrella voucher BIOUG02996-E04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 432.625 | 3.20e-116 | 83.7% |
| 423 | KR043893 | Erythroneura rubrella voucher BIOUG02716-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.7% |
| 424 | KR032657 | Erythroneura rubrella voucher BIOUG02719-A03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.7% |
| 425 | KR033099 | Erythroneura vitifex voucher BIOUG02910-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 418.75 | 4.81e-112 | 83.7% |
| 426 | KR031096 | Erythroneura rubrella voucher BIOUG02718-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.7% |
| 427 | KR041330 | Erythroneura rubrella voucher BIOUG02517-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.7% |
| 428 | KR034201 | Erythroneura rubrella voucher BIOUG02517-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 418.75 | 4.81e-112 | 83.7% |
| 429 | KR038735 | Erythroneura vitifex voucher BIOUG02715-G05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 416.767 | 1.90e-111 | 83.7% |
| 430 | KR032345 | Erythroneura vitifex voucher BIOUG02718-D04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 602 | 90.1% | 416.767 | 1.90e-111 | 83.7% |
| 431 | KJ209071 | Erythroneura rubrella voucher BIOUG03739-D09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 452.448 | 3.45e-122 | 83.6% |
| 432 | KY830563 | Cicadellidae sp. BIOUG04904-C04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 446.501 | 2.13e-120 | 83.6% |
| 433 | KF919407 | Draeculacephala crassicornis voucher CNC#HEM400227 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 444.519 | 8.41e-120 | 83.6% |
| 434 | KF919414 | Draeculacephala portola voucher CNC#HEM400253 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 444.519 | 8.41e-120 | 83.6% |
| 435 | KF919410 | Paraulacizes lugubris voucher CNC#HEM401118 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 440.554 | 1.31e-118 | 83.6% |
| 436 | KR039384 | Erythroneura vitifex voucher BIOUG00941-A11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 434.608 | 8.10e-117 | 83.6% |
| 437 | KR043338 | Erythroneura vitifex voucher BIOUG01139-B08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 434.608 | 8.10e-117 | 83.6% |
| 438 | KR036932 | Erythroneura vitifex voucher BIOUG00941-H01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 434.608 | 8.10e-117 | 83.6% |
| 439 | KR035579 | Erythroneura vitifex voucher BIOUG01139-A10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 434.608 | 8.10e-117 | 83.6% |
| 440 | KR569534 | Erythroneura vitifex voucher BIOUG00941-C08 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 432.625 | 3.20e-116 | 83.6% |
| 441 | KJ163323 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03516-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 426.679 | 1.97e-114 | 83.6% |
| 442 | KR044511 | Erythroneura vitifex voucher BIOUG02517-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 603 | 90.3% | 410.821 | 1.17e-109 | 83.6% |
| 443 | KR578464 | Erythroneura bakeri voucher BIOUG00936-F06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 436.59 | 2.05e-117 | 83.5% |
| 444 | KR560629 | Erythroneura vitifex voucher BIOUG00941-C09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 436.59 | 2.05e-117 | 83.5% |
| 445 | KR043463 | Erythroneura vitifex voucher BIOUG01297-B11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 647 | 96.9% | 434.608 | 8.10e-117 | 83.5% |
| 446 | KJ089173 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03447-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 434.608 | 8.10e-117 | 83.5% |
| 447 | KJ083814 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-C06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 434.608 | 8.10e-117 | 83.5% |
| 448 | KR035668 | Erythroneura vitifex voucher BIOUG01297-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 426.679 | 1.97e-114 | 83.5% |
| 449 | KR031607 | Erythroneura vitifex voucher BIOUG01308-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 426.679 | 1.97e-114 | 83.5% |
| 450 | KR030724 | Erythroneura rubrella voucher BIOUG02602-B04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 424.696 | 7.80e-114 | 83.5% |
| 451 | KR040164 | Erythroneura rubrella voucher BIOUG02715-H07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 424.696 | 7.80e-114 | 83.5% |
| 452 | KJ091199 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02999-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 424.696 | 7.80e-114 | 83.5% |
| 453 | KR036693 | Erythroneura rubrella voucher BIOUG02716-H06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 422.714 | 3.08e-113 | 83.5% |
| 454 | KR042005 | Erythroneura rubrella voucher BIOUG02717-A05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 422.714 | 3.08e-113 | 83.5% |
| 455 | KJ207659 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03903-E09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 633 | 94.8% | 422.714 | 3.08e-113 | 83.5% |
| 456 | KR032197 | Erythroneura vitifex voucher BIOUG01516-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 422.714 | 3.08e-113 | 83.5% |
| 457 | KR031745 | Erythroneura vitifex voucher BIOUG02636-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 420.732 | 1.22e-112 | 83.5% |
| 458 | KR043216 | Erythroneura rubrella voucher BIOUG02517-D07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 420.732 | 1.22e-112 | 83.5% |
| 459 | KR043814 | Erythroneura rubrella voucher BIOUG02718-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 420.732 | 1.22e-112 | 83.5% |
| 460 | KR040671 | Erythroneura vitifex voucher BIOUG02636-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 420.732 | 1.22e-112 | 83.5% |
| 461 | KR044941 | Erythroneura vitifex voucher BIOUG02718-F01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 624 | 93.4% | 420.732 | 1.22e-112 | 83.5% |
| 462 | KR032937 | Erythroneura vitifex voucher BIOUG02718-F04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 623 | 93.3% | 418.75 | 4.81e-112 | 83.5% |
| 463 | KR042095 | Erythroneura vitifex voucher BIOUG01296-G06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 648 | 97.0% | 428.661 | 4.99e-115 | 83.4% |
| 464 | KR039332 | Erythroneura vitifex voucher BIOUG00935-H10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 638 | 95.5% | 424.696 | 7.80e-114 | 83.4% |
| 465 | KJ085990 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02980-E11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 466 | KJ167407 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-G09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 467 | KJ163076 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03637-D10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 468 | KJ163275 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03516-F09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 469 | KJ164498 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03639-C10 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 470 | KJ163540 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02983-D06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 631 | 94.5% | 418.75 | 4.81e-112 | 83.4% |
| 471 | KR033663 | Erythroneura vitifex voucher BIOUG02715-H09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 416.767 | 1.90e-111 | 83.4% |
| 472 | KJ167943 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03635-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 630 | 94.3% | 416.767 | 1.90e-111 | 83.4% |
| 473 | KR036749 | Erythroneura vitifex voucher BIOUG02715-B03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 629 | 94.2% | 414.785 | 7.51e-111 | 83.4% |
| 474 | NC_082903 | Empoascanara hongkongica mitochondrion, complete genome | 664 | 99.4% | 436.59 | 2.05e-117 | 83.3% |
| 475 | KJ089258 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02961-D11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 430.643 | 1.26e-115 | 83.3% |
| 476 | HQ985147 | Draeculacephala sp. BOLD:AAG2883 voucher BIOUG| 656 |
98.2% |
428.661 |
4.99e-115 |
83.3% |
|
| 477 | KJ083757 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02944-G12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 428.661 | 4.99e-115 | 83.3% |
| 478 | KJ086837 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG02966-F11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 428.661 | 4.99e-115 | 83.3% |
| 479 | KR034835 | Erythroneura elegans voucher BIOUG00783-G07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 426.679 | 1.97e-114 | 83.3% |
| 480 | KJ164202 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-H05 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 426.679 | 1.97e-114 | 83.3% |
| 481 | KJ167193 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03685-H11 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 426.679 | 1.97e-114 | 83.3% |
| 482 | KJ165937 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03443-H03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 426.679 | 1.97e-114 | 83.3% |
| 483 | KR033339 | Erythroneura elegans voucher BIOUG00936-B02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 426.679 | 1.97e-114 | 83.3% |
| 484 | HM374379 | Draeculacephala sp. BOLD:AAG2883 voucher BIOUG| 651 |
97.5% |
426.679 |
1.97e-114 |
83.3% |
|
| 485 | KJ444267 | Erythroneura sp. BOLD:ABA5798 voucher BIOUG03734-H04 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 650 | 97.3% | 424.696 | 7.80e-114 | 83.3% |
| 486 | KR034501 | Erythroneura vitifex voucher BIOUG00771-B01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 422.714 | 3.08e-113 | 83.3% |
| 487 | KR032124 | Erythroneura vitifex voucher BIOUG01643-B07 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 639 | 95.7% | 418.75 | 4.81e-112 | 83.3% |
| 488 | KR583803 | Erythridula sp. BOLD-2016 voucher BIOUG00917-B06 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 422.714 | 3.08e-113 | 83.2% |
| 489 | KR573230 | Erythridula sp. BOLD-2016 voucher BIOUG00552-F02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 422.714 | 3.08e-113 | 83.2% |
| 490 | KJ087728 | Arboridia sp. BOLD:AAN8285 voucher BIOUG03247-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 422.714 | 3.08e-113 | 83.2% |
| 491 | KJ164654 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02944-E02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 422.714 | 3.08e-113 | 83.2% |
| 492 | KF919596 | Draeculacephala robinsoni voucher CNC#HEM401035 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 420.732 | 1.22e-112 | 83.2% |
| 493 | KF919482 | Draeculacephala robinsoni voucher CNC#HEM400264 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 420.732 | 1.22e-112 | 83.2% |
| 494 | MK907390 | Ramosulus corrugipennis voucher CCDB-30312-A09 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 652 | 97.6% | 420.732 | 1.22e-112 | 83.2% |
| 495 | KR577182 | Draeculacephala robinsoni voucher 10BBCHEM-0479 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 420.732 | 1.22e-112 | 83.2% |
| 496 | KR041241 | Erythroneura elegans voucher BIOUG00906-D03 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 651 | 97.5% | 418.75 | 4.81e-112 | 83.2% |
| 497 | KJ091606 | Arboridia sp. BOLD:AAN8285 voucher BIOUG02977-F12 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 414.785 | 7.51e-111 | 83.0% |
| 498 | KF920428 | Draeculacephala robinsoni voucher CNC#HEM400262 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 412.803 | 2.97e-110 | 83.0% |
| 499 | KR578542 | Draeculacephala sp. BOLD-2016 voucher HEMI 0101.02 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 656 | 98.2% | 406.856 | 1.83e-108 | 82.9% |
| 500 | KR562009 | Erythridula sp. BOLD-2016 voucher BIOUG00947-E01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial | 657 | 98.4% | 406.856 | 1.83e-108 | 82.9% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Empoascanara | Did not match any candidate |
Database coverage of Taxon of Interest EmpoascanaraThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Empoascanara
Flag 5.1A:
The reference data supports this taxon well
20 records
There are 20 sequences in the reference database for Empoascanara at the given locus COI.
Global occurrence records for Empoascanara.
Database coverage of species in genus Empoascanara
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI Database coverage of species in genus Empoascanara that occur in country of origin Australia
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus COI |
||||||||||
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
No candidate species to report on.
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |